Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc15n04
Contig Information
Length 606 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc15n04   
Homology (BLAST) Top Hit hypothetical protein OsI_36458 [Oryza sativa Indica Group]
Score 398
Evalue 3.91276e-37
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>whsc15n04
CGGCGGCACGCGGCGGCGCAGCTTGTTTCAAGGTCGGCACATCCTGCAGGCCAGTTGAAGTCGGCCTACCACCCCTGGACCAGCCCAAAGCCGAGTCACG
GCCGCACCGCAACTCGCCAGCTTCCGCGCACCAGCTGCGCCGCCCTCGCCAGGCAGCGATATCTCCTATCTCTCCTGCCGGCGGGTCGGTGGTTCCAGCG
GACAAGATGCTGGGCGTCTCCACCAGCCAGCTTTTGGTCATCCTCGGGGCCTGCTCCGTGATGATGAAGCCCAGTGACATGATCAAGATGGCAAGGGTGG
CAGGGAGGATGACCGGGAGAGCGGTCGGTCGCCTCATGCTCTACCGCCGGCAGATGGACGACATCTTCGAGCAGACTGCAGCGAAGAAGATTAATACGGA
GCTTCAAGATGCCATGTCAAAGTTACAATCAATTGGTTATGAAGTTCAGAACTTATCTAGAATAACTCCTGGCCAGTTTATCAAAAGGCAGCACAACACC
GAGGGCATGACTGAAGCAGGAACATATGATGGTTCTGCAACTCANTCTGGAGAATTTCGTGATGATATTCNCAGTATAATTCNTGATGAAATTGANAGCT
TTTGTA
page-top