Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1576
Contig Information
Length 275 bp
Tissue Seed DPA20
Clones 3 Clones [Download: CSV  ,  FASTA ]
whdp10d09    rwhdp10d09    rwhdp10d10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC_Os10g31750 [Oryza sativa (japonica cultivar-group)] >gi|125575019|gb|EAZ16303.1| hypothetical protein OsJ_030512 [Oryza sativa (japonica cultivar-group)]
Score 111
Evalue 0.000400913
Total Hit Count 12
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1576
TTTTTTTTTTAGACACAAGCGCTCATATATACGCGCATACACTCATCCTATGAATGCACACACGCACACCCTATCCCTATGAGCACCTCCGAGAGACTGA
GCCGACATATCATCTTGAGATTTACGAAGTCACCGTAGGCGCCTCGTCGTCGAAGGGAACGTCTCCTTCCATTGAAAGCGCATCGCCGGAAATCCTGAAA
TAAATCCAGGAATAATGCGAGCACCAGGATTTGAACCCTGGTGGGTTGGGGATACCACTGTCCACCTAACCATCT
page-top