Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1562
Contig Information
Length 725 bp
Tissue Seed DPA20
Clones 3 Clones [Download: CSV  ,  FASTA ]
whdp18o04    rwhdp10c22    rwhdp18o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0670400 [Oryza sativa (japonica cultivar-group)] >gi|50251344|dbj|BAD28320.1| putative high mobility group protein [Oryza sativa Japonica Group] >gi|50252158|dbj|BAD28154.1| putative high mobility group protein [Oryza sativa Japonica Group] >gi|113537226|dbj|BAF09609.1| Os02g0670400 [Oryza sativa (japonica cultivar-group)]
Score 487
Evalue 2.78193e-47
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1562
AGTTCTTACACAGGTGGTTAGCAAGAGAAAAGCATTGGAACAGCTGGTAGCATTCTCTGCTTCCTCTCTGCTAATACACTACTAAACAACTTCTCAAACC
ATGAGTCCACAAGTCTAAAAGGGCCCCCTTAACACACAAACACAACATCTACTACCAAATCTCATCATCTAGCACTGAGGATAGCAGGATAGCAAACTAG
TACACTAAGCGGGGACCCAACACCCAATTTGCTACCTCATGATCTGATACACTATTTACTCGTCATCGTCCTCATTTTCCTCATCGCTACCCTCATCTTC
GACCTCAGATTTGACCTCCTCATCGTTCTGAGTCTTGGCCTTCTTGGAGCTCGCACTCTCCTTGTTATCAAAGGTGGCTTTGGTCTTCTCATAATCCTTC
TTCTTCTGTTCAGCCTTTTCCACATAAGGTGCTTTCTCCTCATCAGACATAGCTCTCCACTTCTCACCCGCCGCCTTGCTCACGTTGGCGACACTCTTGT
TGTTGGGGTTCTCCGCGTTGTACTGCTGCCTGAACTCAGACATGAAGACGAAAAAGGCGGAGGGCGGGCGCTTGGGCTTGCCAGCGGCAGCGGCGTCCTT
CTTCCTCTTGCTGGCGCCGCCGGCGGCCTTGAGCCTGCCCTCGCCCTTCTTGGAGGTGTCAGCCTTGCCCTTCATGGTGGAGGCCGCGGCGCGGGTACGG
AGCTAGGGTTTTGCGGGGGGGCAGA
page-top