Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig726
Contig Information
Length 1060 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 4 Clones [Download: CSV  ,  FASTA ]
whfl10b02    whfl16h05    rwhfl10b02    rwhfl16h05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os11g0473000 [Oryza sativa (japonica cultivar-group)] >gi|77550860|gb|ABA93657.1| ER lumen protein retaining receptor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645103|dbj|BAF28244.1| Os11g0473000 [Oryza sativa (japonica cultivar-group)] >gi|215740777|dbj|BAG96933.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765653|dbj|BAG87350.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1095
Evalue 1.67285e-117
Total Hit Count 328
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig726
gcCCGGCCCCACCTCTCAGTCCTCACCCTGCCCCCTCCATTCGCCCCCCTCCCGCCGACCAGAGAGGCAGGTCGCCGCCGACGAGATCTGAGAGCTCCGG
AGGCCGGATCCCGGCCGCTCAAAGGCACGCGGAGATGAATCTGTTTCGGCTCGCCGGGGACATGACCCACCTCGTCAGCGTGGTGGTGCTGCTCCTCAAG
ATCCACACCATCAAGTCGTGCGCAGGCATATCTCTGAAGACGCAGGAGCTATACGCACTAGTTTTTGCAGCTCGCTACCTGG*ATCTGTTTGTGCATTTT
GTATCTTTGTATAACACCGTCATGAA*GCTGGTCTTCCTGGCGAGCTCTTTCTCAATAGTTTGGTACATGAGGAAGCATAAGATCGTGCGTAGGACCTAT
GACAGGGAGCACGACACCTTT*CGCCATCATTTCATAGTGCTGCCATGTTTGGTTCTGGCTCTCCTCATCAATGAGAGATTTACCTTTAGAGAGGTAATG
TGGGCATTCTCCATTTACTTGGAAGCCGTAGCAATTCTGCCTCAACTTGTGTTGCTACAGCGCACAAGGAATATTGACAACTTGACTGGCCAATATGTCT
TTTTCTTGGGTGCCTACCGCGTACTTTATATCCTCAACTGGATTTACCGATACTTCACTGAGCCCCATTTTGTTCACTGGATAAGCTGGATTGCGGGTAT
CGTGCAGACTATGCTGTATGCTGACTTCTTCTACTATTACATAATAAGCTGGAAGAACAACGTGAAGCTAGAGCTACCAGCCTGAGCCGCTGTTTTCTTC
CAAGATAGACTAGGTATTACGGCTTGCTTAACTTAATGGATAGACAGGACAGATATGGATCATATGATACAGATGTGCGTTTTGGGTTCCTGGATTTTCT
TGTTTCCTTCCAATGTTTTCGGAGGTGAAAGCTAGGTTCGCCTTGTATCTTGTAAGGTAATATAAGGAGGTTGTGTACTTGTGATACTGTTTTGGAACTC
GATGAAGGTGCTGCTGCTGTACTCCCTTTGGCGAGTGTATACTGCTTATATGGTTAtatt
page-top