Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc19c23
Contig Information
Length 673 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc19c23   
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Hordeum vulgare]
Score 1042
Evalue 1.05241e-111
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc19c23
TGGGCTTGTGGTTCTTTACATCACCATCAACGTGTTCAAGATGTACTACGGTGATGACTGGGAAGGTCTTTTTGAGTCCATCACTGGTTATGGTCTCGGT
GGGTCTTCCATGGCTCTATTCGGAAGAGTTGGTGGAGGTATCTACACCAAGGCTGCTGACGTGGGTGCTGACCTTGTTGGCAAAGTTGAGAGGAACATTC
CTGAAGATGACCCAAGGAACCCAGCTGTGATTGCTGACAACGTCGGTGACAATGTTGGTGATATTGCTGGGATGGGATCAGATCTCTTTGGTTCATACGC
AGAATCGTCCTGCGCTGCTCTTGTTGTTGCTTCTATCTCATCTTTTGGAATCAACCATGATTTCACTGCGATGTGCTACCCACTGCTCGTGAGCTCTGTT
GGCATCATTGTTTGCTTGCTCACCACCCTGTTTGCGACTGATTTCTTTGAGATCAAGGCTGCAAGCGAAATTGAACCTGCTCTGAAGAAGCAGCTCATCA
TCTCCACTGCTTTAATGACTATCGGTGTTGCGGTGATCANCTGGTTGGCTCTCCCAGCTAAGTTCACCATCTTCAACTTCNGTGCTCANAAGGACGTGTC
CAACTGGGGCCTGTTCTTCTGTGTGGCANNTGGTCTGTGGGCTGGTCTGATTATTGGGATTGNGACCNAATAC
page-top