Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc14d24
Contig Information
Length 624 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc14d24   
Homology (BLAST) Top Hit Os11g0143500 [Oryza sativa (japonica cultivar-group)] >gi|113644428|dbj|BAF27569.1| Os11g0143500 [Oryza sativa (japonica cultivar-group)]
Score 564
Evalue 2.3767e-56
Total Hit Count 67
Registered year 2003
Contig Sequence     [ Download ]
>whsc14d24
CGCGACTCGACCGCCGCCGCGCACCCACTCCCGCTCCCCACGATGCGGCACCTCCTCCTCTCCCGTCTCCTCCGCCGCGCCTCCTCCCCCTCCCAGCCTC
ACCACAACCTCCAACTCATCCGTGCTCTCTCCTCCTCCTCCCCTCTCCCGGCCTCCGACACCGACCTCCGCAAGTACGCCGGCTACGCGCTCCTCGTCCT
CGGCTGCGGCGCCGCCACCTACTACTCCTTCCCCTTCCCACCCGACGCGCTCCACAAGAAGGCCGTCCCCTTCAAGTACGCGCCCCTCCCCGACGACCTC
CACACCGTCTCCAACTGGAGCGGCACTCACGAGGTCCACACCCGCGTCCTCCTCCAGCCCGACTCCATCCCGGCGCTCGAGGATGCCCTCGCCACAGCCC
ACAGGGAGCGACGCAGGCTCAGGCCCCTCGGCTCCGGGCTGTCCCCCAATGGCCTCGGGCTCTCCCGGGCCGGCATGGTCAACCTTGCGCTCATGGACAA
GGTGCTAGACGTCGATGTCAAGAAGAAGACCGTCACGGTGCAGGCTGGGATACGTGTCGCCGAGCTCGTCGATGCGCTCAGCAAGCATGGGCTCACACTG
CAGAACTTTGCCTCCATTCGAGAG
page-top