Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1502
Contig Information
Length 628 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a04    whdp4j13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MTN3 [Zea mays]
Score 505
Evalue 1.67062e-49
Total Hit Count 211
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1502
TGATCCTTGTGTCACCGGGAAAGGGAGTAGGAGAGGGGACTCTTGGCTCCGGGACACTAGTTCTTGGCTAAGATCTTCTCCCTCCCTCCTTTCCTCTCCC
TCCAGCTGATACCTTCACTAGCTAGCAGTAGCCGAGTCTTCTTCGCCGTCGTCGTCGCAATGGCTGGGGGCCTCTTCGACATGTCTCACCCGGCGAGCGC
CCTCGCCGGCATCGCAGGAAACATCGTCTCCTTCTTCGTGTTCCTCGCGCCAATGGCGACGTTCCTGCAGATCTACAGGAAGAAGACGACGGGCGGGTTC
AGCTCGGTGCCGTACGTGGTGGCGCTCTTCAGCTGCTCGCTGCTCATCTTCTACGCGCTGCTCAAGACCCACTCCCCCCTCCTGCTCACCATCAACAGCT
TCGGCTGCTGCATCGAGACCGTCTACATCATCGCCTACCTCGTCTACGCGCCGCCCCGGGCCAGGCTCAGGACGCTCGCCTACTTCTTCGTCCTCGACGT
CGCCGCCTTCNGCCTCGTCCTCGTCGTCACCATGTACGCCTTCGCGCCGGCCCACCGCGTCAAGTTCCTCGNCAGCGTCTGCCTCGCCTTCTCCATGGCC
GTCTTCGTCGCGCCGCTCTCCATCATCC
page-top