Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1501
Contig Information
Length 654 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10c19    rwhdp10c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Thalassiosira pseudonana CCMP1335]
Score 85
Evalue 0.910056
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1501
CGGACATAGAGAGAAGGATGAGGGAACCTCCAGAAGAGGATGAGTTTAAGTTGCTTGTCGAGTCCTACGCACGTACGATTGATGGTGTGGTCCATGGAAC
TGCCAAGATGGCACTTCTCTGCATCATTCCATTTGCCCTTTTTGCCGGCGACAACAACAAGGGGGTAGAAGCAGAGTCTGTTACCAAGGAAGACCAGTGA
AGACAAACATCCAAAGACGAGAACCAAAGATGGACCCCTACTTGTTTTCAGTTAAATTATGATGACCTGCAGTTTCGCTAGCGAGCACTATGCTATCGTT
GTGATTTTGTGTAACATGGTACCATCTATTCGACATGAAACTTGTAGGTTGATGAGAACATGCATTGCATAGCTTGTATGGTCACTGGCATGCATTTTGC
TGCTACTGGAGTGCTTGAATCAACTTAGAGGTGTTAACTCTTCTTCTGAAACTAATTGTGTGACGTTATCCTTTCACTTCATGACTGCCCTGTGTTTTTC
CCCATCACCAAAGGGGCGGGCTCGTCTTGTACAGATCCTCTTAACTTCATGGCTGCCCTGTTTTTCTCCTGTCACCAAGGGGCGTGCTAGCCTTGATCTA
TTCATTCTGGGCGTTCTTTCTCATCAACATGAGGTTATTTATTTAAAAAAAAAA
page-top