Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc10j23
Contig Information
Length 302 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc10j23   
Homology (BLAST) Top Hit hypothetical protein OsI_25960 [Oryza sativa Indica Group]
Score 410
Evalue 8.58651e-39
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc10j23
AAATGGTTAAGCNAACTGGTTGCAAATACNCTGGAGTTACTTTGTCAGAGGAGCAGCTTAAATACGCCGAGAGTAAAGTAAGAGAAGCTGGCCTAGAGGA
CCACATAACTTTTCTGTTGTGTGACTATCGCCTAATACCACCTTACAAGTATGATGCGATCATAAGCTGTGGGATGATCGAACATGTTGGCCATGAATAC
ATGGACGAATTTTTTGCCTGCTGCGAGTCTTACTTGGCTGAAGATGGCATATTGGTCCTCCAGTTCATCTCAATTGCAGAGGAACGATACGAGCAATACA
GA
page-top