Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1500
Contig Information
Length 957 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10d01    rwhdp10d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0180200 [Oryza sativa (japonica cultivar-group)] >gi|50252089|dbj|BAD28019.1| unknown protein [Oryza sativa Japonica Group] >gi|113535621|dbj|BAF08004.1| Os02g0180200 [Oryza sativa (japonica cultivar-group)] >gi|125538336|gb|EAY84731.1| hypothetical protein OsI_06100 [Oryza sativa Indica Group] >gi|125581039|gb|EAZ21970.1| hypothetical protein OsJ_005453 [Oryza sativa (japonica cultivar-group)]
Score 815
Evalue 4.20152e-85
Total Hit Count 488
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1500
CTTCTCTCGCCACCCCTTCTTCTCCACCGTCCCTCCCCTGGAGCGAGCGAGCCCTCGTCTCACTCCCCGCGATGGCTTCCTCCACTGCTCTCTCCCCGGT
GGCCTTCAAGTCCTCCTTCTCGCCGCTCCCCTCCAGACCAGCTCGTACTAGGATAAATGTACAAGGCGCATTCTGTTTGCCATGTTCCACTTGGAAAAGA
GCTAATAATAGATCGTTCCGGGTATACAGTTTATTTGGAGGAAAGAAGGAGAAAGATGAGAATGGTGACGAGGCACCATCAAAGGGAGGAATCTTTGGAA
ACATTGGAAATATGCAAAACCTTTATGAAACTGTGAAGAAGGCCCAAATGGTTGTCCAAGTGGAGGCTGTGCGGGTGCAAAAGGAGCTTGCAGCGACTGA
GATTGAGGGTTATTGTGAAGGCGAACTAATCAAGGTTACACTATCTGGGAACCAACAACCTATAAATGTTGAAATCACGGAAGCTGCAATGGAGTTGGGT
GCTGAAAAAGTCTCCGAGCTGGTCAATGAAGCCTACAAGGATGCACACCAGAGGAGCGTCCAGGCAATGAAGGAAAGGATGGCTGATCTAGCGCAGAGCA
TAGGAATGCCTGCAGGGCTCGGCGACGGTCTCAAGTGATAAAAGGCCTGGTACTTGAATGCTTTCCAATAATGAAAGAAGCGTCTCTCAATTTTGTATTC
TAGCTGTGTCGGGTCATGGTTAAACCCCTCCGCAGCATCGGTTAGCTGTGCATGAACTGTAACTGTGGACACCTGTTTCCTTGCTCATTTGCACATCATA
GTTACAGCATTAGTTCTAATGTGTTGTTTTACACCAAACAGATGTTGCTTTTGTGCTAGTAGACCGGCAGCCTGGAGAACATTTGTAAACTAATAACTGC
AGAGTGAAATATGTTTACGTTGCGAATAGAGTACTCTTTGGTTATGGATATCGACAT
page-top