Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_DPA20_all.Contig1499
Contig Information
Length 567 bp
Tissue Seed DPA20
Clones 2 Clones [Download: CSV  ,  FASTA ]
whdp10a22    rwhdp10a22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194701316|gb|ACF84742.1| unknown [Zea mays] >gi|195613194|gb|ACG28427.1| vesicle-associated membrane protein 725 [Zea mays]
Score 370
Evalue 5.79801e-34
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_DPA20_all.Contig1499
GGACCACCCTGAAGAGATAAACAAGCTTGCTAAAGTGCAAGCACAAGTTTCAGAAGTGAAAAACGTGATGATGGAAAACATTGAGAAGGTTCTTGATCGT
GGTGAGAAGATTGAGCTGCTTGTTGACAAAACAGAGAATCTCCGCTCACAGGCCCAAGATTTCAGGCAGCAAGGAACACAGGTGAGGAGAAAGATGTGGC
TACAAAACATGAAGATCAAGCTGATCGTCCTGGGCATCATCGTCGCGCTCATCCTCATCATAATCCTGTCGGTGTGCCACGGATTCAACTGCGGCAAGAA
GTGAGGACAAGTCGAGGTCGCGAGACACATTCAACTGCCCCTATATTACTCTGCTGATTCGAGCAAAAACCATATATATGGTGCTTAGTTCTTTTCTTGT
CTAGTGTGCGCTGGCCCGGGCCGTGGTGCCTGTGGGTGGGTCTGTGTTTTCGTTGTCGTCGTGTTGGGATGTTCGGTTACCGCTGGATGGGTGGTGGCTG
GGTCGGCGGGTCGTGTATTTTTGGACGCTATGTATGTATAGCTTGGATCTGACGCCTTGTTCTATGT
page-top