Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig72
Contig Information
Length 523 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl4e05    whfl54e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_31349 [Oryza sativa Indica Group]
Score 465
Evalue 4.53154e-45
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig72
acGAGCACGAGCACTCCATGGCATGGCCACTTCCCTGGCCGCTCTCATCGCCGGCGCCGCCACCGTGAAGCAAATACGGCAGCTCCACGCCAACCTCCTC
ACTTCAGGCCGCCTCCCCTCCCTCGGCCCTATCCTCCTCCGCCGCCTCATTTCCCTGCCCTCTCCCCACCTCCACCACGCGCAGCGCCTCCTCCTGTCCC
TCCCCTCTCCGCCCCTCGCGCTCTTCAACCTCCTCCTCCCCCCACTCGCCTCCTCGCCCGATCCCGCCGCAGCGGCCCGCCTCTTCGTCCACCTCCGCCG
CAGCGGCCTATGCCCTGACGCGCACACGCTCCCGCACGTTCTCAAGGCCCTCGCGCGCCTCGCACCGGGATCCCTTCCCCTCGTCGCCTCCACACACGCG
GAGGCCGTCAAGGACGGCTTGGACTGCGCCGTCGTCTACGTACGAAACGCCCTAATGGCCGCCTACTCGGCCTGTGGCCAACCGGCGCGCGCCATGcagg
tGTTCGACGAAATGCCGCGCcgg
page-top