Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc6m08
Contig Information
Length 512 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc6m08   
Homology (BLAST) Top Hit conserved hypothetical protein [Aurantimonas sp. SI85-9A1] >gi|90336396|gb|EAS50137.1| conserved hypothetical protein [Aurantimonas sp. SI85-9A1]
Score 342
Evalue 1.28264e-37
Total Hit Count 166
Registered year 2003
Contig Sequence     [ Download ]
>whsc6m08
AAGTCGGCCATAGTGATCCGGGAGTCCCGTGTGGAAGGGCTCTCGCTCAACGGATCAAAGGTACGCCGGGGATAACAGGCTGATGACTCCCAAGAGCTCT
TATCGACGGAGTCGTTTGGCACCTCGATGTCGACTCATCACATCCTGGGGTTGAAGAAGGTCCCAAGGGTTCGGTTGTTCGCCGATGAAAGTGGTACGTG
AGTTGGGTTTAGAACGTCGTGAGACAGTTCGGTTCCTATCTACCGTTGGTGTTAAAGGGAGAACTGCGAGGAGCCAGCCCTAGTACGAGAGGACTGGGCT
GGGTCAACCTATGGTGTACCGGTTGTTATGCCAATAGCAGCGCCGGGCAGCTAAGTTGGTATGGAAGAACTGCTGCGCCGCGGGAAATCCTTCTCTATAC
AAGTTCTCGTACGAGGTTTTTGAACANAACTTCNATAGGCGAGAGGTGTAAGCACCGCGAGGTGTGAANCGATCTCGTACTAAACGAATGGAAATTGACA
ACAAAAAAAAAA
page-top