Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc2e11
Contig Information
Length 773 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc2e11   
Homology (BLAST) Top Hit hypothetical protein OsI_23231 [Oryza sativa Indica Group]
Score 532
Evalue 1.90447e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc2e11
TTACGAGCTGCTGCGTTATTGTAGTATATAAGAAATAAAAACCACCAGCTAACACAGCATCCCCTCGTATATTCACAAGCAGTGTGACTCTAGTAGCAAC
AGAACTCACACGAAAACCATTGATTTGGCCAGCTCGAGGGCCCTTTCCCTGCCAAAGAGCTTCTCCACGATGGCAAGCGAGAATTCCATGGAAGTGCCTG
GACCTTGGCTAGTGATCAGGTTGCCATCGACAACGACTCTGTTCTTGCATTCGCTTTGGTCCGTGAGTTTGCTCCACATAGCAGGATAGGATGTAGCCTT
CTTTCCCTTCAGCAGGCCATGTGGCTCAAGGGCAATTGCTGGGGAGGCACATATGGCTCCATACAGTTTGTTTGCCTCCGCTTGCTTCTTTATGAAACCA
ATCAGTTTATCTGATTTGGCATATGCTTGGGCACCACCAACGGCGGCGGGATGAGGACGATCTGCGATGTGTGCGAGAGCGCGGTGGCGGTGCTCTTCTG
CGCGGCCGACGAGGCCGCCCTCTGCCGTCCCTGCGACGAGAAGGTACATATGTGTAACAAGCTTGCTAGTCGGCATGTAAGGGTTGGGCTTGCGGACCCT
AATAAATTAATACGCTGTGATATATGTGAAAGTTCTCCTGCTTTCTTCTACTGTGACATANATGGTACATCACTTTGCCTGANCTGTGATATGGCTGNTC
ATGNTGNNGGNAAANNAACCCNTGNAANATACTTGCTGCTANNANAANNANNCNAATTTCCNNGANATNANNC
page-top