Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc16g07
Contig Information
Length 724 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc16g07   
Homology (BLAST) Top Hit hypothetical protein OsJ_022634 [Oryza sativa (japonica cultivar-group)]
Score 939
Evalue 1.07634e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc16g07
AAACGTATGATATTTGAAATCATTGTGCAAAGTATCAACAAGTAGAAAGAGCATCCAGGAGGCATTTAACTGGGACATCATTACNAANACACTGAGCTTG
CGAAAGGCACATAACAGATCCACAGCTAATAGCCAGCTCCGCAGTCAAAATTCCAAGCCTCAAGCCTTGCTGGCAATGTTACTGGATAGCCAGTCCAGGC
CCTCATACAGACCCTCACCGGATGTAGCACATGTGCTCTGGATGTACCAGTGACGTTGACGAAGGGAATGTAATCCAAGCTTATCAGTAATTTCAGCAGC
ATTCATAGCATTTGGAAGATCTTGCTTGTTGGCAAAGACAAGCAACACAGCATCGCGCAACTCATCCTCATTCAGCATCCTGTGGAGCTCATCTCTGGCT
TCAACAACACGGTCCCTATCATTGCTGTCCACAACAAAGATAAGACCCTGCGTGTTCTGGAAGTAATGCCTCCAGAGAGGTCTGATCTTGTCCTGACCCC
CAACATCCCAAACAGTGAAGCTAATGTTCTTGTACTCGACAGTTTCAACATTGAACCCTATGGTTGGGATAGTGGTAACGATCTCGCCGAGCTTCAGCTT
GTAGAGGATGGTGGTCTTTCCGGCAGCATCAAGACCGACCATGAGGATCCGCATCTCCTTCTTGGCGAAAAGCCGGCTGAAGANCTTCCCGAACGCGAGC
CCCATCTCGCCCTACCCCTCTTCC
page-top