Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9g13
Contig Information
Length 775 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9g13   
Homology (BLAST) Top Hit calcium-dependent protein kinase [Triticum aestivum] >gi|164472652|gb|ABY59008.1| calcium-dependent protein kinase [Triticum aestivum]
Score 933
Evalue 6.09013e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9g13
AGCTTGCAGAAGAAAGTAGGTCCAAAACACTAGAGGAACAACATGCACGAGCAAAAGGCCACAAGATATACACAATCATCTCAACAACGCCAAAGAGAAC
TTCTCATCCGTGCAGCAGCGAAAAAAGGAACCAAGAACAGTTGCTAATGGTACACCATTTCTAAGGAAAGACTACTTGAGCCTTATTGGCTGCTGCATCC
CTCCTCTCATCATAGCGCAGAATTCCTCGTAGTTAATCCTCCCATCATTATCTGTGTCGACTTCTGATATGATGTCCTTTATGGTATCCGCATCGCCCAT
TTCATGCTCAATCAAAGCAGTCTCCAGTTCATCTCTTGTGATGAAGCCACTGTTGTCTTTGTCAAAGTACTGGAACGCCTTGAACAAATGCTCGTCTCTT
TCGAGCTTGTGTCTATGCATGGTTGCTGTTATGAACTCAACGTAGTCAATTGATCCATTGCCATCCACATCAGCCGCATCCATCAACTGCTTTACTTCAG
CTTCTGAGAGCTTCGATCCAAGTTTGGCTAGTCCTGCTTTGAGTTCCTCATATGTGATTGTCCCACTGTTGTCTGTGTCCATGTTCATAAACATTTGCTT
CAGGCCCTTGATCTCTTCCTCATTAAGATTTGAAGCTATAACCTTTAGAGCCATCTTTTTCAGTTTATTCATTGCTCTGAATTGCTTCATCCTANAAAGA
ACAGCACTGTCAATAGGTTTATCTGATGCTTCTCCTTCCCTGAGCCATGGATGTTGAANAACTNGGGCTGAACTA
page-top