Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc16g10
Contig Information
Length 729 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc16g10   
Homology (BLAST) Top Hit Os12g0502300 [Oryza sativa (japonica cultivar-group)] >gi|122248577|sp|Q2QQ96|CCA21_ORYSJ RecName: Full=Cyclin-A2-1; AltName: Full=G2/mitotic-specific cyclin-A2-1; Short=CycA2;1 >gi|77555843|gb|ABA98639.1| Cyclin, N-terminal domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113649335|dbj|BAF29847.1| Os12g0502300 [Oryza sativa (japonica cultivar-group)]
Score 684
Evalue 4.06177e-70
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc16g10
GGGAGATATTTACAATCTCTTTCCCCCCTAAATCTACAAAAATCAGTTCAAGACTATTGACTTAGGCCTAGGCCGTTGGGCCTCAGGAATTAAGAATGGT
TCCAAATTGGAGGAACAAAAATCAAAAGCACTGTTTTTCTCTTGGAGAAATGCTTGAGTCAGTCAGCAGCCTCCTGTATGATGCTCAGAGCCCGCTTCAG
CCTCAGCCGCGACCGCGCGGCGAGCTTCCCGTTGCTCTTCTTCGCCGCATTCTTTCAGGGAAGAAACACAAGAGATAAATCTGAAACTGCCGACTCAAAC
ACTGGGGACTATGTTGGCTTAAACGTTATAGACATTGACAAAGATAATGGCAATCCACAAATGTGTGCTTCCTATGCGGCAGAGATATACAGAAACCTAA
TGGCTGCAGAGCTTATAAGGAGACCTAAATCAAATTACATGGAGACTTTGCAAAGGGATATCACGAAGGGCATGCGGGGCATCCTGATTGATTGGCTTGT
TGAGGTTTCTGAGGAATATAAACTTGTGCCAGACACACTATACCTCACTGTATATCTTATTGATCAATTTCTTTCTCGGAAATATATTGAAAGACAGAAA
CTACAACTTCTTGGAATAACTAGCATGCTGATTGCCTCAAAATATGAAGAGATCTGTGCGCCTCGTGTTGAAGAATTTTGTTTCATAACTGATAACACAT
ATACAAAAAATCAGGTGCTGAAAATGGAG
page-top