Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc3f11
Contig Information
Length 718 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc3f11   
Homology (BLAST) Top Hit SC3 protein [Zea mays]
Score 797
Evalue 3.08903e-83
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc3f11
GTAGGACTTGTCCACTTTTCTTACCGGCGATAAAGAAAAATATATGTTTACATTGCTACATATATTTTTCTTTACCGTGCCATCTAATCCATGGAATTAA
TCTTGAGACCTATCATCATCTGAGATATGTGGCAATCAAAATGCCGCTCTCATAGCGCCCCTCGTCGCATCACGCTTCATCTCTGCGGCCTTTCCACTTC
CTCGGAAGTACATGTACACTTGCTGGATAACCCAGATGCTCAGCAATGACTCCAGGGCAAATAATCCAAATCCAATGAAGTAGAAGATCCCAACTAGAGC
ATTCACGCTGATAAGATCAATCGCCGGTAAAATTCCTGCCAAAGACTTGCCCTCAAAGACAGCAGGAGGAGCCACGGCAGCAAATACGACGAAAATGATG
TGAAACAAGTAGAGCAAGAAAAACAATCCAAACTTCAACGCACTGTCAGTCCTCATAGCATTATAAAGAGGGCGATACCATAACACATACGCACCAGGAA
CCCCAGAGATGAAGTAGATTATTGCTAGCAACCAGATTTTCACACCTTCCCCCTTGATCCAGGCTGAAGTAACTGCTACGACATTCCAGAAGAGACAGAA
AACCAAACCAAGAAATGACGCAAATGCGAAGTATTGCATTCTTTGAAGATGAGTCGGTATCTCATTGGCAATGTCATGGTGGATGAGTGGCAGAAAAGGA
GGCCAGTTTTTTCTCCTC
page-top