Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1i05
Contig Information
Length 682 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1i05   
Homology (BLAST) Top Hit Os02g0137500 [Oryza sativa (japonica cultivar-group)] >gi|122064234|sp|Q6YXY2|HACL1_ORYSJ RecName: Full=Probable histone acetyltransferase HAC-like 1 >gi|113535361|dbj|BAF07744.1| Os02g0137500 [Oryza sativa (japonica cultivar-group)]
Score 222
Evalue 1.31905e-16
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>whsc1i05
CGCGTGTGTGTAAGGGATGCTGAATGAAAGCGTTTGTGAACACCTCGCCTCTTCCCCGCGTTCTCATCCTGTTCAGCGTCTCTTCTCTCCCCGAATTCTC
CACTCCCTGATCCAAATCAACGCGATCTCATCATAGACGAGGCACTACAAGTGCTCATCCTTACTCCTCTAGAAACCTTCGCCACATCAGTCGACCCCAC
GTTTTGATTGCGGCTGGCTGCGAAGGTGAGCGAGGGGCAGGCGGCACAAATGAATCGGTTGGGCGGCAGTGGCACTGGCGGCGCCGATGTGCCACCGCTG
CAGCATCAGCAGTTGGAGGAGGTGATGGGCCACGGCGATCCCATGCTAGTGGCGATGCGCAACAATTACCGCCAGAGGATATTGGAGCATGCAGAAAGGG
TGGTCACTGCGAGATTACATAACGGATTGAGGGTACCTGATGACTGGCAGCGGGGGCTGCCGGAGCTTGCTAGGCGGGTCGAGAAAGTCTTGTTTGAGAA
ACACCCAAACAAGAGGGAGTACTACAACATGACGAATGAACCAATTCANCCACATTTCNAGTTTGCTGTCACNACCTCNCTTGCTCANACTGANANGCAN
AGAGCATCTTCCACTGCCTATGCTCNNGNCACCCAANGGGATACCCCCAACNANCTTGTNAACACANNANTATCTCTGGNNA
page-top