Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1i02
Contig Information
Length 285 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1i02   
Homology (BLAST) Top Hit hypothetical protein OsI_34122 [Oryza sativa Indica Group]
Score 372
Evalue 2.22837e-34
Total Hit Count 23
Registered year 2003
Contig Sequence     [ Download ]
>whsc1i02
TCTCATTTGGCCCAGATGAAGCATTTATTCCCAGAAGCAATCCAGATAAATAGGATACTCTTGCATGATCAGAAAAGCCTATGCATGTATGCTGACATGG
AAATTACACTTCTGAAGGACGCTGTGGAATGTAGTAATCCTCAAGAGTCTCCAGCCATTGCAATGTGTGAGGCTTTTCGCTCAAAGCTTTTATGCTTCTT
GGGATCTCATCATAAGGATATCGATGTTCCTGAGGCCACACTACCAGAACCCTTTAATTTAAGGGAGGAGCTATATCTTGATGCA
page-top