Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc16g12
Contig Information
Length 217 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc16g12   
Homology (BLAST) Top Hit hypothetical protein OsI_03962 [Oryza sativa Indica Group] (no hit)
Score 1061
Evalue 8.33661e-114
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc16g12
TAGCAACCAGCATGGCAATACCCCAAATTACAAAATAGAGCTAACTGCAAGTAAAATCCACCTTTCTCAATGTTACATATGAGTTCGAGCAAGCGTGCTG
GCAAATCTCAAATTATTCAATGATGCGATCATTCCTTGACCCACCCCAAAACTATAGCGACAAAATCGGCTGCAGCAATTTTGGCTTCAGAGGGCGCAGT
GTTTTTTTTTTTACTTG
page-top