Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1h23
Contig Information
Length 757 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1h23   
Homology (BLAST) Top Hit hypothetical protein OsI_03962 [Oryza sativa Indica Group]
Score 1061
Evalue 8.33661e-114
Total Hit Count 470
Registered year 2003
Contig Sequence     [ Download ]
>whsc1h23
ATGGATTCAAAAGCTCCTACTGAGAAGCTTTATCTCCCAAAGCCTAACATTTTCGTTCCAAAGGATTTATCTCTTAAAGAAGTGCCAGACAAGGTTACAT
TTCCGACAATATTAAGGAAGACGCCACTTTCACGGCTGTGGTATAAGCCCGACATGCTGTTCTTCACTCCGAAGGTTTACATTATAATTGATTTCCACTG
CCCATTGTCAAGCCACTCCCCCGAAGCAGCCGTATCTACAAGTCTGTTTGTCGATTTGTTAGTCGATTACTTGAATGCTTATGCTTATGATGCTCAAATT
GCGGGTTTATTCTATTCGATATATCTTACTTCTACTGGATTCCAGGTGTGCGTAGGTGGTTACAATGACAAGATGAGAGTTCTGCTACATGCCATAATGA
AGCAAATAGTGAACTTTGTAGTTAAACCAAACAGGTTTTCTGCCCTGAAGGAAACTTCTGTCAAGGACTACCAAAATTTTAACTTCAGCCAACCATATTC
TCAAGCTTCGTATTATCTTTCATTAATACTGGAAGAGAAAAAATGGCCTTTGGTAGAGAAACTTCAAGCTCTTTCTAAGCTTGAGTCAGATTCTCTTGCG
AAGTTTGTGCCGCACTTGCTGTCGAAGACATACTTGGAATGCTATATTCAAGGAAACATTGAGCCAGGTGAGGCTGAGTCTATTGTCCAGGAGATTGAAG
ATACTATATTTAATACCCCCAAATTCTGTATTCAAACCCATGGTCTCCATCACAATA
page-top