Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc3h15
Contig Information
Length 857 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc3h15   
Homology (BLAST) Top Hit hypothetical protein OsJ_008102 [Oryza sativa (japonica cultivar-group)]
Score 901
Evalue 3.75544e-95
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc3h15
AGATGCATCCATCTCAGGAAATTCTCAGTTCGACAGAGTATACGGACCAGACCAGGTACAAATTCCCAACTGGAAACCAAATGCACGGAAAACAGAGACC
CAACAGTGTAACTGTTAACGAATACAAGGAAGGATGTGACTGACTAATCTATGGAACATGGAGTAAAATCTGAAATGTCCAGAGGAGAAGGAAAAAAAGA
AGGCAGAGATTACCAATCAGGCAGAATCAGTGCTTTTATGCGCATTTGCGAAACCAATATCACAAATCTTTCTTGTTGACAAGTATGTTCGACGGGTGGG
TGGCGGCACAGAAATCAGCACCCCATGACAGCACAGTTATAAACAAAGTTGCCAGAAGGTTTGCTTCCGATCATGTTCCATTGCAAGGGGCCCTCCCTTG
GGATCCACGAATGGAGTTCAATCATCCCGCCGCCCAGCACTCTTGGTCCACCAATCACCAGGAGCCGCTCTCCGCATCCTCGGAATGCAATGCCCCAGCC
ATTCACAGCTTCTGGGCGCTCTGGTAACTCCCCAAGAGTTGTCCATGTGTTATCACTTTTATTATACTTCCTTACTAGTTTTCCTGCATATTGAGCCGCA
TATAGCTCATTGTCAACTACAGCAACAAGGGGAGGAGCACCACTGGCACCATTGAGACCCTCTGACATGTTCTCTATCAACCTCCAGGTACCCTTCTCTA
AATCATACTCTTCTCCGCATGTCAGCACCTCCGTGTTACTGGCCATTCCACCAATAACATAAAACTTGCCATCCATGAAGACTCCAGAACACATTCTCCT
ACGCTTGTTCATGCTCGGAAGTGTAACCCAACTTTTAGTTTTCANAGTTGTACAGCT
page-top