Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc3f17
Contig Information
Length 814 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc3f17   
Homology (BLAST) Top Hit hypothetical protein OsI_35523 [Oryza sativa Indica Group]
Score 799
Evalue 2.2923e-83
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc3f17
GGTGTGGACGATGAGATGATTTAGGCAGAGTTACATTTGCAAGTGCCCACCAAATTAACTACATTGACATAATTGCTTGTACAAATTACTCTGGAATCTG
CGTTCCAGGTTTTGAGGGATGCAATCTAATAACCCTGATAAAGATCATACTTGCTAGCATGCATTACTTTTCCATTCTTTCTAAAGAATCAAGAACTTAT
TGATCAACTTATACATCCTTGAGAACTGAACTCTTGTAGCAAGACTGAAAAATCCTAATCTATTTTTTTTCCATATCCAGCTGCTTTTGTAGGTACACTT
AGTCGCCAATGGGTGGATAGGTTGTGTTTGGGAGCCTCTGTCCAAGCACAAATGAGCGAAATAGGCCGAGAGCTCGGTCTGGCTGTGCAAATGGCACCAT
GTGAGATGCGCCCCGCACTGTTGCAAAGGTCAGAAGATTACCGTACTCTGTTGTCCAACCTCCAACCTGGCCTTTGCGGAACCAAGTACTGTACGGAACT
GTGACAGGCAACCCCATGTCATGAGCTAGCTCTCGCACAAGGGTTCGGGAGCCCAAGAGGGGCACCACAGAGTCTTGATCGCCGCTGAATATCCAAAGTG
GTATCTTATGTTCCACTATTCTCCGAAGTAAAGGCAAGATGTTGATGTTACCATCCTTATCGGTGTAATTCAGCACATCACTGCACATGCCCCAGCCATA
AGGTAGATGTGTTCTATTANCATGAAGAGCATGCTGCACTTCTGGAAGATTGAAGTANAAGTACCTTTCATATGACATGCAAACATCCACTCCTAACTGA
TCTTGGNCACATAT
page-top