Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1h13
Contig Information
Length 116 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1h13   
Homology (BLAST) Top Hit hypothetical protein LOC100217003 [Zea mays] >gi|194697358|gb|ACF82763.1| unknown [Zea mays]
Score 155
Evalue 3.22187e-09
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>whsc1h13
AGGTCTTAGCATGTTTCTACCAGATGAATTCGACTATGCATTGTATGCCGATGACTGTGTCAAAAACTTTGGTGTTAGGCCAAGGCCTCGATGGATCTCT
ACAGAGTTTGGTGGTC
page-top