Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc3g03
Contig Information
Length 824 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc3g03   
Homology (BLAST) Top Hit hypothetical protein OsJ_015592 [Oryza sativa (japonica cultivar-group)]
Score 910
Evalue 3.15084e-96
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc3g03
ATAATCACTGGCCAGCAGGTAGCGAGCATTCTGAAATCTCAACCATATCAACAAGTCGCGGGAACCTCGACTAATCACTCAGCTAAGATGCGCAATGTCG
ACCTCATCAGGTAACTTGAAGGTGTCCGCAGCGCCAAACTTCTTCCTTCCCTCCTTCCACTCGTCCTCGTCCTCCAGGCTGTCGCTGTCGTCATTCTCAT
GCCCGTGGCTTGACGGGGTCGGGGGTTCCTCGACGCTCTTCGACTTGCAGTGGCCGTTGGCGAGCATGGTGACCTGACGGAGATGGGAGATCTCGACGAC
GACAGTCTCGTCGTTGCTGGGGAGTGGCTGCTTCCATGGCTCACCGTCGACCCTCATGAACGTGTGGTCTGCTGCTCCTTTGTGGAACTCGAACCGGATC
CTATGAGCCTGCGCTAGACGAGTTCCGTGTCCATTAGGGGCCAGCAAAACGAGACCATGCCAGGCATCACGGAAGCCGACAACCTCAATGAGTCCATCAT
CAACATAAGGTGCAGTCAGGTCCCTGTCTTGTTTCTTCCTCGTCCCANGGGTTCCCCAGGGATTGAATCCTCCCGAGAAACTTGGCAAATTGAGGCANAT
AATCGATCGAATACTGCTGGGGATTTTAAGCTCTTCCCATTTGCCACCANGTCTTTTCATGATCTTCACCTTTGCAAGTTGCNAAATGTTCCTTGAANAN
GAATGGGTTANANAANGANCAAACCATCCTTGTTTAANTCCAANCTTANCATATGTACCCTGNATTCNATANCTGGNTTTTNAACTTCTCTGGNATTTTT
CTTCCTTTNNNANNGGAACCCATA
page-top