Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc15a04
Contig Information
Length 664 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc15a04   
Homology (BLAST) Top Hit T-complex protein 1 subunit beta [Zea mays]
Score 1071
Evalue 4.41933e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc15a04
CAAGCGAATTGAGAACGCTAATATTTTGGTTGCGAACACCGCTATGGATACAGATAAAGTTAAGATTTATGGGGCACGTGTCCGGGTGGATTCGATGTCT
AAGGTTGCAGATATTGAAGCTGCCGAAAAGCAGAAAATGAGAGAGAAAGTTGAGAAAATCATTGGTCATGGGATCAACTGCTTTGTCAACAGGCAGCTAA
TCTACAACTTTCCTGAAGAACTTTTTGCTGATGCTGGCATCCTCGCAGTTGAGCACGCTGACTTTGAGGGCATCGAGCGGTTAGCTCTTGTCACGGGTGG
TGATATTGCATCAACTTTTGACAACCCAGAGTCTGTTAAGCTTGGGCACTGCAAGCTCATCGAAGAGATTATGATTGGGGAGGACAGGCTGATTCATTTC
TCCGGGGTTGCGATGGGGCAAGCTTGCACCATTGTCCTGAGAGGAGCAAGTGAGCATGTGCTTGATGAGGCTGAGAGGTCCTTGCACGACGCCCTATGTG
TGCTTTCTCAGACAGTAAATGACACGCGTGTCATATTTGGCGGTGGATGGCCTGAGATGGTGATGTCCAAAGANGTGGATGAACTTGCAAGGAGGACCCC
TGGGAANAAATCTCATGCTATTGATGCTTTTTCNCGTGCCCTGCAAGCCATCCCAACAATCATA
page-top