Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc15a01
Contig Information
Length 684 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc15a01   
Homology (BLAST) Top Hit hypothetical protein OsJ_023051 [Oryza sativa (japonica cultivar-group)]
Score 381
Evalue 4.82124e-35
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>whsc15a01
TTCGGCACGAGGGAGGACCTTCACTGGACAACAATATGGTTGCAGTAAAGGAGGAAATGGAGGTCCCTGTGGAGGTAGACAGTGGTAATTTGATCCGCAA
TAATATTTTGGGAGAGGAACATGATAAAGGGTTGAAGGATGCTGTTAATGCTGCACTTAATCCTCACACGCCAGGAGACAGCATATTTGATATTGGTGGA
ACGAAACTGGGGGGCAACATGAAGAATGAAGATGAGGGTAGCTTTAGGATATTTGTAAAGGGGAAAAGCAGGCGAAAGCAAACTCTGAGGATCCCGATAA
GTTTGCTTAACAAGACATATAGCGCACGTTCCTTCAAGCTTGACTTCAACAGAGTAGTCAGAGAGAGTGATATCTTCAAGCCATCGGGCGTTTCTTCTGC
TGAAGTAGTTTCTTCTGGCGACTGAGGAATATTCCACCAGTCAAATATTTACCTATGACATTATTACCCAAAGAGAATTCGATGGATCTCCATTTGAAAA
ATACTGAAATGTGACTCTTATTTTTATCTGAGCATTCGGAAGGCAGCAACAATGCTCCTTCAGTGTTCCAGATTTGATCCAAGCTACTCTGAAAAGATAA
ATGTGTTTTCTTTTCCGACTTCAAATAAGGTGTCGACAATTCCGTGTGGAGTGTAGCAGATTGCCGAGAGTTTTGCGAGATCCG
page-top