Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1g08
Contig Information
Length 497 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1g08   
Homology (BLAST) Top Hit glycosyl transferase, group 2 family protein [Roseobacter sp. MED193] >gi|85825531|gb|EAQ45730.1| glycosyl transferase, group 2 family protein [Roseobacter sp. MED193]
Score 79
Evalue 2.1881
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>whsc1g08
GTTTTTTTTTTGCAAATGCACTAAAATGACATTGTAAATCCACCAATAATCCAAATAGTTTGCTAANATTAAACATTAATAATTACAGNGTAATATTAAA
CATACAGACCACTATTAAAACCAAAAATACTGCTATGCTCAGCTTGATTGCTACTTGGCATTGCCTCACTTGCTGAACCTCACTTGGATTACATGCTAGT
AAAATAANAACTCAGCCACCATTTGTGCTAGGACCGCGCACATTCTGAACCTCACTTGGCATTGCCTCCCGAATCANATGAACAAAAATCGGCAGGAGGC
GGGAAATTGGGGCCGTGGTTGGTGCGGGGGGCGAGATATCCTGCANACAACCGACGGGAGGTCGAGCGGGGCGCGGAGGCAGCAGGGGAGTGGGACAAAG
AGTGCANATGAGTCACCAACAACCAACTGCATCGATCGCCAAGAGGGAGATCCAAATCGCCATTGCCATCTCTCCCAACCTCTGTTCCAGCCTCGTG
page-top