Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1f17
Contig Information
Length 534 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1f17   
Homology (BLAST) Top Hit hypothetical protein LOC100193785 [Zea mays] >gi|194694130|gb|ACF81149.1| unknown [Zea mays]
Score 563
Evalue 2.07166e-56
Total Hit Count 344
Registered year 2003
Contig Sequence     [ Download ]
>whsc1f17
TAGTGTTATAATGTTTAGTGGTGTTTTCTCTCTGCTTAATACGTTGTCATTGTAATTGTGCCTGCATTCTTACAGATAAAAGATGCCGAGGGAGGGATTC
TGTTTGTGGATGAAGCTTACAGGTTGATACCAACGCAAAAATCGGATGATAAGGATTATGGTTTGGAGGCACTGGAGGAGATAATGTCTGTAATGGACAG
TGGCAAAGTAGTTGTCATATTTGCTGGGTACTGCGAGCAAATGAAGCGTGTCATTGCCTCGAACGACGGTTTCTGTAGGAGGGTCACGATGTTCTTTGAT
TTTGATGATTTCACCACGACAGAATTAGCGGAGATATTGCTTCTGAAGATGAATAGCCTGACTGACACAAGTTTGCTTTACGGGTTCAGGCTGCACCGGA
NCTGCACCAGAGGTGCCGTTGGAGAGCTGATTGCCAGGGAGACCACTGANGAGTGGCTTAAACAGATGAACGGAGGTCTGGTANACACACTGCTTGTCAA
TGCACNTGAAAACTTGGATCTTCCNCTTGATTTC
page-top