Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1f16
Contig Information
Length 611 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1f16   
Homology (BLAST) Top Hit hypothetical protein OsI_09342 [Oryza sativa Indica Group]
Score 954
Evalue 1.35624e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc1f16
CGGATCCTTTCTTGCATATCCGGGTTCTTAAACTTATGCGTATGTTGGGTCAAGGTGACGCAGATTGCAGTGACTATATGAATGATATTCTCGCTCAGGT
CGCAACAAAAACTGAGTCAAACAAGAATGCTGGAAATGCCATCTTATATGAATGTGTTGAGACTATAATGGGTATTGAAGCTACTAGCGGTCTACGTGTC
CTGGCTATTAATATTCTGGGTAGATTCTTGTCAAACCGCGATAACAATATAAGATATGTTGCTCTGAACATACTTATGAGGGCCATTACAGTAGATTCAC
AAGCCGTACAGAGGCACAGGGTGACAATATTGGAGTGTGTAAAGGACGCCGATGCCTCCATTCGCAAAAGGGCCCTGGATCTTGTTTATTTGTTGGTCAA
TGATACAAATGTGAAGCCTCTGACCAAAGAGCTCGTCGACTACTTACAAGTAGCTGATCCAGACTTCAAAGAGGATCTCACAGCCAAGATATGCTCCATA
GCTGAAAAGTTTTCTCAAGAAAAGTTATGGTATCTTGATCAGATGTTCAAGGTTTTATCCCTGGCTGGAAATCNTGNGAAAGATGATGTGTGGCATGCCC
TTATTGTTGNA
page-top