Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1f09
Contig Information
Length 628 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1f09   
Homology (BLAST) Top Hit hypothetical protein OsJ_009251 [Oryza sativa (japonica cultivar-group)]
Score 453
Evalue 1.78905e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc1f09
TTTTTGGGTGTAACAAATGAATCTTTTCTCTGTCCACAAAAATCTTAATCAAATACAGTTAACAGAAACCAGCGCATGCCTCTTCGCAGTGAACAAAACA
CCTCGCAAGCATGCGCGATCGGAGCTCTACCACGTGGTCATAGTTCACGGTCAAACTCTACAGCCTACGGCAAACCTCTGGGAAGCGGTTCCAGCTTCCA
GCTACATCTGCTTATAACCTATATTTAGTGATATAGTCCTAATATACAAGTCTAAAGGGAAGGGGTAGGGCACAAAGCAAGCTGCCCTCAAGCAGAGATC
ACGCGTACGTCGTCCCAGCGCAAGAACTTCGTGGCTGCCACATAACTCATTGCCTCTTGGGCTCCTCACCGGGAACTTCAGCAAAGCAGACAGGGCATAC
CTTGTTGATGGTAAGCCATTTTGTCACGCAGCTGGCATGGTACACATGCTTGCAGGGGAGCGCCATCTGCAGATCCCCTCTCCGATACTCCATTTGACAG
ATCACACACCTTTCACGGCGTTTTTTCTTCCTTGAAAATAAACCACACTTGAATTTGGTGACTGGAAGTGNTGAAATGCTTTCTTGGGAGAGACCCCGAC
TTTGGGTTNCAACTGCCTCGCCCAAATC
page-top