Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1f05
Contig Information
Length 140 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1f05   
Homology (BLAST) Top Hit hypothetical protein OsI_08032 [Oryza sativa Indica Group] (no hit)
Score 846
Evalue 8.42884e-89
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>whsc1f05
CCCACGGTCTCCTCCATCGTCAAGATCGTATGTGTGTCGTCCTCAGTCCAACCCCATGGCATTAGGATGGCCGAGTTTGTCGCGAGCAACAGTCCATGGA
TGTCGGCTTCAACTTTCCTCCGCGAAGGTCCCTTTTGCTC
page-top