Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9l20
Contig Information
Length 711 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9l20   
Homology (BLAST) Top Hit Os07g0124600 [Oryza sativa (japonica cultivar-group)] >gi|28201305|dbj|BAC56813.1| putative Heterogeneous nuclear ribonucleoprotein [Oryza sativa Japonica Group] >gi|113610341|dbj|BAF20719.1| Os07g0124600 [Oryza sativa (japonica cultivar-group)] >gi|125557092|gb|EAZ02628.1| hypothetical protein OsI_24740 [Oryza sativa Indica Group] >gi|125598981|gb|EAZ38557.1| hypothetical protein OsJ_022040 [Oryza sativa (japonica cultivar-group)]
Score 166
Evalue 8.26662e-14
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9l20
GGTCTATTGCCGGTTGCAATGTACACAAGGNCCAAAGTAAGCGCAGGATTTCCACACATGTATTGTCACCAAAGAATTTCATCTCAAGTTCTTCACAGTT
GCCGAGTTCCCAGATAACAAGTTGCTGTCCATCGTTACAATGTTGTAACAGTAGCCTGGTCATCCATGCCCAAAGTTTCTTGCCTGGTAGCTGGTAGGTC
CACTTGTTGCTCTTTTATGTCTTCAATCAGTTTGTTATCACTTTTAGCTTCCCCAAGTTGAGCACCAAAACGATTTGTATTCACGTGATCATACCCATAC
CCAATTGTTCCATAGCCTGTATAGAGTGAACCTTGCCTTGTCAAGGGGACTCCTCCATTCATCATGTAGACATACTCTGGTAAGCACATGTATTGTGGCA
TAGGCATCACATAATGATTATTAACAATATGCTGCATGTGAGGTGGGTATGCTCCAGCAAAGCCAATGGGAGGATTGTTGCCATCCCATATCATAGGATT
ATATTGTCGCGTATCCTGGTAGTAGCTATGACCCTTGGGAATAGCTCTCTTAGTTTCAACCTTTGTACCGTTCAAATCATGGAATTTACTCTCCAAGACA
TTTACCATAGCCTCCTCTGAATCAAATGTAATGAAAACCAAAGCCTCGTGATCTCTGACTAGCCCCCTCACGTATCACAACAACATCTGTTATTCTGCCA
AGGGGGGGCCC
page-top