Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc14p18
Contig Information
Length 669 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc14p18   
Homology (BLAST) Top Hit hypothetical protein OsI_35968 [Oryza sativa Indica Group]
Score 1005
Evalue 2.0102e-107
Total Hit Count 277
Registered year 2003
Contig Sequence     [ Download ]
>whsc14p18
TGGCACATTTGAAATAAACTGGTTCAAAGGACATTAAAGTTCAGGGTGTTATTGGACCGTGTACATCTTTGGAGAAGAAAGGAGCTTTATGTGCAGACAC
AATTGTCGGTCAGGGAAACACAACAGCATGGAAAATGTGTGGGCTTGATAGGAATACTTCACTTACAGTTTTTTTTGATGTCTCACCGAGTGAACGCTCT
GGCCAACCAGGTCATCAAAATCCCGATTTGTACATACAGTTTGTAACCAGTTACCAACACCCGGAAGGTCAAATGAGAATAAGAGCTACTACTGTATCCA
GAAAATGGGTGGATGGTTCTACCAATACTGAGGAACTAGTCGAAGGATTTGACCAGGAAACTGCAGCTGTTGTGTTGGCAAGATACATCTCCTTGAAAAT
GGAAATAGAGGAAGAGTTTGATGCAACACGGTGGCTCGATAGATCTCTCATACGACTATGTTCAAGATTTGGGGATTATCGGAAGGATGACCCCTCTTCA
TTTAGCCTACATTCTAATTTCTCACTGTTTCCTCAGTTTATGTTTAATCTCCGGCGTTCGCAATTTGTTCAGGTTTTCAATAACAGTCCANATGAAACAG
CCTATTTCCGAATGTTACTCAACCGANAGAGTATCACTAATTCANTTGCAATGATTCANCCGTCATTAA
page-top