Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc16g18
Contig Information
Length 728 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc16g18   
Homology (BLAST) Top Hit Os03g0209500 [Oryza sativa (japonica cultivar-group)] >gi|108706783|gb|ABF94578.1| zinc finger family protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113547806|dbj|BAF11249.1| Os03g0209500 [Oryza sativa (japonica cultivar-group)] >gi|215768485|dbj|BAH00714.1| unnamed protein product [Oryza sativa Japonica Group]
Score 614
Evalue 5.26968e-62
Total Hit Count 58
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc16g18
TACACTGCAATCTGTCGAAACACACCAGAATGCTACTGTTAGCAACACACTAGCAGTTTGCATGAGCTAACATCAAATGAGCATTGCTCTAACATCGTCG
CTAACAAAATCTAACCCTAGATTACAAATTAACCAATGTTTTCCCAGCTTTGCTCTGCCATATGCAGTGATTCTCCAGGTACCAACACCACGCAGCTTCT
TCCTACCATTTCTGTTGGTCAGATGAGCACATATAACTAGCTTGACCTGCTGTTGTTAAGAAACCCTTCAGACGATGGCATGTGCTGGTCAGGCGCCTGT
CCAGCCTGACCAGAATGCAGAAGCGAGTTAGCCCAGTTGGCCGATCTGTGAACAATTCTCGATGGGATGCGGTCACTGTCCTCGCCTCCCGACGCCTCAT
ACCCGTCGCTCGTCGATCTTGTGAACTCAATGTGGCTCTGAGCCGCATGCGGCATAACTCCCAGCATTTCGTCGGCGGTGCATGAAGAAACTCGAAATGG
GTGGAGATCAGGTGAATCGAAGCTGCTCTCAGGCGACGAGACGGCAATTCTGGAGGATGCCGCGGTGCTTGGTTGGAAAGCGCTCCTCGCTTCGAGCTGC
AATGGGGCTAGACTGGCAGAAGCTTCCATTGCCGCGTCACTGAAGTTGCTCTCGGTGCCGCTTGCCGAAAGCCTTGCGAGGGGATCGAGAGAGAGTTCGG
CGGGGAACCGCCCCCTCCTGCTGTCGNG
page-top