Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1e12
Contig Information
Length 803 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1e12   
Homology (BLAST) Top Hit N-acetylgalactosamine 6-sulfatase (GALNS) [Lentisphaera araneosa HTCC2155] >gi|149140314|gb|EDM28713.1| N-acetylgalactosamine 6-sulfatase (GALNS) [Lentisphaera araneosa HTCC2155]
Score 81
Evalue 4.0212
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whsc1e12
CATTTCTATAATTGCTACAGAGAGGGTGCAGTTCACTACACAAGGTTAATTTTAAGATACCATAAAAAAGGTTAATTTTAAGCATCAGAGCACACAGTTC
GTGCTCTTGAAGTCTTTGAGAGAGATTCTTACATTCATGCTCAACTGCATACTAGTTAGAAGAAACTAATTAGTGCTAGTACATCATAACACGAGTCTTC
CGTTTCCTTTATACATTCTTTATTTTCCGTGCATTTTTCTAGCATTACTAATCATGGAACAGTACAACGAGNGCACGTCAAGCACCATCTGCTAGCATCA
CTTGTTGAAGTACGTGTAGGCCGGGTTCAGTCGCGCAGCAACTCGAACAGGTCCTCTAGGGTACTATCAGCAGCCTGTCCATCTTCCAAGCCAGCCCATT
CTCTCACAACAGCCTCCACTGTTACAAAATTAGCTGCGTACCCCTGCTGCACGTCACCATCTTGTTGCACTCCCACGACACGACCATTTGCAATAACTGG
TCCTCCTGAGCATCCACTCATTGATTTGCAATCATGCCTCATCCTTTCCTTCCAGTCCATTTCTTTTGTTTCCCTGATTTTTGGTCCAACAATGCTTCCA
GGACATGCTCCGGGTTCAATGGGAATAGGATTGTTAGTCTCCTCCAACTTATCGGGAGTGTAGTATGCCACTAACACGGCATCTGTTCCAATCGTTAAAG
TTGTCTCACTGGAAAATATCAAAGCCGGATAATTCTCAGGCATTCCAAACACAGGCGATAATCGCTAGGTCTTTCTTGGTATCCTGGTAGAGTATTTCAC
ACT
page-top