Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc3g12
Contig Information
Length 430 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc3g12   
Homology (BLAST) Top Hit histone H2B.2 [Zea mays]
Score 348
Evalue 1.33466e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc3g12
CAGAGTTCCACAGACAAGCACTAAGCNAACAGCAAGGAACTACATTTGCTACTAGATACNGGCGACGCGATCTAAGAGGANGTAAACTTGGTGACGGCCT
NGGTGCCCTCGGAGACGGCGTGNTTGGCNAGCTCCCCAGGGAGGACGAGGCGTACGGAGGTCTGGATCTCCCTGGAGGNGATGGTGGGCTTCTTGTTGTA
NCGGGCGAGCTTGGCAGCCTCCCCGGNNAGCTTCTCGAAGATGTCGTTGATGAANGAGTNCATGATGGACATGGCCTTGNAGGANATGCCGATGTCAGGG
NGCACCTGCTTCAGCACCTTGANNATGTANATCTTGTAAGTNTCNACGCTCTTCTTGCCCTTCTTCCTGCCCCTCTTCTCGCCGCCCTCNTTGNAGGCGG
TCTTGCCCGCCGGAACCCGCTTCTCGGCTC
page-top