Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1e09
Contig Information
Length 281 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1e09   
Homology (BLAST) Top Hit hypothetical protein OsI_19876 [Oryza sativa Indica Group]
Score 412
Evalue 4.97769e-39
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>whsc1e09
TGTCTCTGACTTCGTTAAAGTAGGAGGTGTCCAAAAGTTGCAGGATGGCGAATTTATTGTCCAGGCTACAAAGGACTGTGTAGCTAAGACATTGAAGAGG
CTGGAGGAGAAGATAAATGGACGAGTATTAAAACACTTGGTTTATCTCATGAGAGTAGGAGAAAAGTCTGTGCAGAGGCGTGTTGCTCTGGCTCTTGCAC
ACCTCTGTGCCCCTGAAGATCAGCGAACAATTTTTATTGATAATAATGGTCTCGACTTGCTTCTTGATCTTCTGGTTTCNG
page-top