Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1a04
Contig Information
Length 283 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1a04   
Homology (BLAST) Top Hit retrotransposon protein, putative, unclassified [Oryza sativa (japonica cultivar-group)] >gi|77548920|gb|ABA91717.1| retrotransposon protein, putative, unclassified [Oryza sativa (japonica cultivar-group)]
Score 176
Evalue 1.15145e-11
Total Hit Count 329
Registered year 2003
Contig Sequence     [ Download ]
>whsc1a04
GGGGGAGGACTGGAGCTCGTCAAATAAGTCGGGGAATTTGGTGTGACACCAATTTCCGCCCACCACGTCACGGAAACAACTCCAAACGAATCGCGCGGAG
ACGCAGGAGAAGATGTGACTCGAGTCCTTGGGAACGCCGCAAAGAGGGCAGAGGCCGGATCCCGGGCCATTGCGCTTGCGGACCTCAACGCCAGACGGGA
GTCGACCGCGAATCCACTGCCACATGAAGATCCAGATTTTCAGGGGCAGGCGGATGGACCACACCGTCACAAGGGGGGGGGGG
page-top