Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9n11
Contig Information
Length 708 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9n11   
Homology (BLAST) Top Hit Os04g0534400 [Oryza sativa (japonica cultivar-group)] >gi|113564987|dbj|BAF15330.1| Os04g0534400 [Oryza sativa (japonica cultivar-group)] >gi|116310461|emb|CAH67465.1| OSIGBa0159I10.10 [Oryza sativa (indica cultivar-group)] >gi|215701032|dbj|BAG92456.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195276|gb|EEC77703.1| hypothetical protein OsI_16778 [Oryza sativa Indica Group]
Score 264
Evalue 1.89808e-21
Total Hit Count 234
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9n11
ACAACGATTTGGGATCACACTCTTACCATTTTATTCGCCATTTACTCTGACCATACTATAATGGCCATGCCCAGGCAAATGTGTGGGCCTGCATTGCTAT
TTTCAGTAAAGGTCCTATGTTGGATCAGGAGACGAAGCTCACCTTGGAGGCTTCCTCTTCTCGGTATTTCTCGGGATCATATACAACCATCAAATTGACT
TCATCAACCACTTCACTGCCCTTGCTGTTGAACATGCGATCAGTAATTTCCTCATCTGCTAGACCCTCCTTCAGTTTTATGCTCTGCACGACAAACTTGT
CCCCATTCGTAACTTGTGTTGCACTCTCCTGTGATTGAAGTGTGATCTTCACCTCACGCTTGCCTCCTGGCAGCACAATGCCTTTGTCTGGCTGAGCGAT
GTACTGTTCGCTTGGCGTTAGGATGTTAAAGGCAGTGGAATTACTTGTCTCGTTGGTTAGCTCAACTGAGCACGAAATCTGCTTGTTATGCTCGAAATGG
AAACGCAGCTCCAGTGGCTCAATCCCAAGCATGTCATCATGCTGGCATAGACTAGTCTGGCTAATTGACCCACTTGTACTTCCTGTTTCGCTTAGATCGC
GGATTATCTCATTGATAGAAGGTCTATTTTCTGGNTCCTGTAAACTGCACCGTAACGCTATTTCCATACATTTAATTACTTGGTGTTGTTGGTGTCNTGT
CGCCGATT
page-top