Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1d18
Contig Information
Length 507 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1d18   
Homology (BLAST) Top Hit putative phospholipase D alpha 1 precursor [Triticum urartu]
Score 857
Evalue 1.39483e-90
Total Hit Count 181
Registered year 2003
Contig Sequence     [ Download ]
>whsc1d18
ATTCGGCACGAGGACGCTGAAGGCCGACAACGCGATCGGGGCGACGCTCATTGGGAGGGCGTACCTGCCTGTCGGAGAGCTCCTGGAAGGGGAGGAGATC
GATAGGTGGCTTGAAATCTGTGATGACAACCGGGAGCCTGTTGGTGAGAGCAAGATCCATGTGAAGCTTCAGTACTTTGGCGTTGAGAAGGACCGCAACT
GGGCGAGGGGTGTCCGGAGCGTCAAGTTTCCTGGTGTTCCTTACACCTTCTTCTCGCAGAGGCAAGGATGCAATGTTAGATTGTACCAAGATGCTCATGT
CCCAGACAACTTTATCCCCAAGATTCCGCTTGCGGACGGCAAGAACTATGAGCCTGCCAGATGTTGGGAGGATATCTTTGATGCCATAANCAATGCTCAG
CATTTGATTTACATCACTGGTTGGTCTGTGCACACTGANATCACCTTGATTANGGACACCAATCNCCCCAAACCTGGAGGAGACGTCACTCTCNGAGAGT
TACTCNA
page-top