Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1a05
Contig Information
Length 111 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1a05   
Homology (BLAST) Top Hit Os08g0389500 [Oryza sativa (japonica cultivar-group)] >gi|113623687|dbj|BAF23632.1| Os08g0389500 [Oryza sativa (japonica cultivar-group)]
Score 95
Evalue 0.000127867
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc1a05
GCGACCTTAATGAGGAGGTGTACGTCACCCAGCCACCAGGGCTTCGTTGCCAAGGGCCACGAGCAGGGCGTGTATCGACTACACAAGGCCCTCTATGGTC
TCCGGCAAGCC
page-top