Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1d11
Contig Information
Length 429 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1d11   
Homology (BLAST) Top Hit GJ19212 [Drosophila virilis] >gi|194149660|gb|EDW65351.1| GJ19212 [Drosophila virilis]
Score 78
Evalue 2.70293
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>whsc1d11
AACATCTCTTTTTTTATGCGAAAAGGTACACCAATCATCTGAACATACAAATATGACGGTAAGGAGTTCTTGTAATCTCCTCTAAGAAGTACTAGTACTA
TTAATCAACAAGCCGATCCCAATTTCCAATATGGAACACATAGCAGCTGCACCAAATCTGTTCCTTGTCGCTTAGAACTCAACTTAGAAGCAAGCATCCA
ACAGACAGCAGCAACAAAGGGCAGCCAAGCATCCCTCCATGAAGGAGGGGCCGCTGCTCTGCTGCTGCCGCGGAGGCTGCTGCGCGTACTGAGGCGGGTA
CCCCTGCTGCGGGTACCCTTGCTGCGGCGGGTACCCACCCTGCTGCGGCGGATACCCCCCTTGCTGTGGCGGATAACCCTGCTGCGGCGGGNATCCCTGG
GGANGATNNCNCTGNNNNTGNNNNNNNNG
page-top