Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1c20
Contig Information
Length 134 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1c20   
Homology (BLAST) Top Hit putative UDP-glucose dehydrogenase [Sorghum bicolor]
Score 200
Evalue 1.91489e-14
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>whsc1c20
CCCTCCCGATCTACGAGCCCGGCCTCGATGACGTTGTCAAGGCCTGCAGGGGAAAGAACCTCTTCTTCAGCACTGATGTTGAGAAGCATGTCGCCGAGGC
CGACATCATCTTCGTCTCATCTGAACACCCCCAC
page-top