Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9m20
Contig Information
Length 409 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9m20   
Homology (BLAST) Top Hit hypothetical protein OsI_07847 [Oryza sativa Indica Group]
Score 340
Evalue 1.12153e-30
Total Hit Count 252
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9m20
TCAACAGGCGAGATGATTCCGCATCAACACGTACTTAGATTGACATCTTCTAACAGAACAGAAACAATCTTCGACATANCTCGCAGAGGAAGCAGGTTAC
GCTGTAGGGACTTGCACTGCACGANCTTCCAAAGCAGGGAACAATAAAGCTCAGCGCCCCCGGCCGCGACCACGCCCACGGCCGCGTCCACGACCCCGAC
CCATAGGCTTCCCTGTAGTTGGCTTCTTAGACTTGACCCTGGGGGTATCCTCAACCAGCAACGTTTCCAGGTTTAAGCTATCAGGGAGGATGTAGTACCG
AATGTTGTTTCCTCTCACGCTGATGTGATCAAGGGTTACAGGATTCTTCCCTTTCATTGTGAGCTTTACGGTCTTCAGATGAGTATTCATGCTTATGTCA
ACACCAGTG
page-top