Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1c03
Contig Information
Length 170 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1c03   
Homology (BLAST) Top Hit benzoxazin6 [Zea mays] >gi|29123084|gb|AAO65850.1| 2-oxoglutarate-dependent oxygenase [Zea mays] >gi|194703630|gb|ACF85899.1| unknown [Zea mays] >gi|195622068|gb|ACG32864.1| 1-aminocyclopropane-1-carboxylate oxidase [Zea mays]
Score 73
Evalue 0.00224505
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>whsc1c03
GGCACGAGGGTCACGGAGTACGGCCACGCGGTGACCAAGGTGGGGCTGTCCGTGCTGGAGCTGCTGTCGGAGTCCCTTGGCCTGANCAGCGACCACCTGC
GCGACATGGACTGCGCGGANAACCTCAACGCCGATGTGCCAATACTACCCACCGTGCCCGGAGCCGTACC
page-top