Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1b24
Contig Information
Length 146 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1b24   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group] >gi|218192269|gb|EEC74696.1| hypothetical protein OsI_10403 [Oryza sativa Indica Group]
Score 104
Evalue 0.00266906
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>whsc1b24
ACGACNCCATCATTCCGTACTCCCGCGGCGGCACCGTCGCGGCTCGCACGGCNAGGGGCAGCCGTACCGGTCGTCCTGCCGCTCCGAGGAGGCGGAGGAG
GACGACCTGTCCATGATCTCTGACGCCTCCTCCGGGCCGCGCCACC
page-top