Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whsc1b19
Contig Information
Length 220 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
whsc1b19   
Homology (BLAST) Top Hit transmembrane 9 superfamily protein member 2 precursor [Zea mays]
Score 332
Evalue 9.37532e-30
Total Hit Count 492
Registered year 2003
Contig Sequence     [ Download ]
>whsc1b19
CTCGTGCCGAATTCGGCACGAGGCACTCGGGCTGGGTGGGTGTTTCATGGAGGACAGCCTGCTTCTTCCCTGGCATCGCGTTCCTGATCCTCACCACACT
CAACTTCCTGCTGTGGGGAAGCCAGAGCACCGGGGCCATCCCCTTCTCGCTGTTCGTTGTGCTGATCCTGCTCTGGTTCTGCATCTCTGTGCCGCTTACA
CTCGTCGGTGGGTTCCTCGG
page-top