Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

rwhsc9o06
Contig Information
Length 647 bp
Tissue Shoot grown with cold treatment
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhsc9o06   
Homology (BLAST) Top Hit unnamed protein product [Oryza sativa Japonica Group]
Score 451
Evalue 3.28053e-43
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>rwhsc9o06
CAGACTACAAAACGTATTCTTATTCTCCTTGTATCGTTGCACGGGAACCCGGTACAGGTATTTTCGTCGCGCAGAGCAGCTCGAGGAAAACAAACACGTG
GAGACTGGAGAGACACATGTGAGAGTCTCTTGTTTTCTCATTGGACGTAGGACTTCTGGGGCCGAGCAGCCGGCCGGAGCTCGCCGCCGGCGAGGAAGCC
GGAGTACCAGCGGGCGGAGCTCCTCAGGTACCTCGTCCTCGCCGCATCGCCCATGTCGACGCCGCACAGGCCGAAGCGCAGCCGGTAGCCGAAGAGGAAC
TCGAACACGTCCAGGAACGACCACACGAAGTATCCCCGCGCGTTCGACCCGTTCCGTATGGACAGGTACAGGGTCTCCATGTAATCTTGCAGGAACTCCA
CTCTGTCCTCGTCGTCCTCCTCCTCCTCGGCCTTGCTCCGGGTGCCGGGGGCGTCTGCGTACCCATTTTCGTGGATCCACACAGTGGGGTTCCCGTANTT
GAGTTTCAGGTGCTCCAGCAGCTTCCTCANGGACCACGGGGCGGTCTCAACCTCNCCCGTGGTTATGTCTGCTGCTGGATTTTCNACNGNTGCATCCACN
TANTANTCCCTGNNTCCCTGNNCNNAANTGNTGTCNATNNATNNNNC
page-top